My favorite part of the arrival of spring is getting back to the garden – especially tomatoes. But I’ve learned not to…
Partial Fetus in Sister’s Brain Supports Role of DNA Repeats in Development

Startling images in the journal Neurology made the media rounds last week. CT scans show a partial fetus wedged within a space (ventricle) in the brain of its one-year-old sister. In photos, the removed potential sibling resembles a pink tadpole.
The report, called a Teaching NeuroImage, is from four researchers at Beijing Tiantan Hospital, and entitled “Intraventricular Fetus-in-Fetu, With Extensive De Novo Gain in Genetic Copy Number.” That means the genome of the doomed fetus-within-a-fetus had lots of copies of certain short DNA sequences that aren’t in the parents’ genomes (“de novo” means new).
With only two short paragraphs, the report doesn’t explore the significance of the discovery of the repeat-riddled genome. But I thought immediately of young children with combinations of developmental delay, intellectual disability, autism, learning disabilities, and behavioral conditions that turn out to have microduplications or microdeletions – that is, bits of DNA copied too many times, or missing. Might the partial fetus have had an extreme version of the DNA repeats that are associated with these syndromes, halting development well before birth?
Short repeats are also called copy number variants, or CNVs. In addition to their roles in development, DNA repeats are used in DNA profiling and are behind a class of inherited diseases. I’ll return to those.
Rare Among the Rare
The partial fetus was trapped inside its conjoined twin. These twins form once in every 50,000 to 60,000 births, when two groups of cells are delayed in separating into two individuals, leading to shared parts.
The most famous conjoined twins are Abigail and Brittany Hensel. Born March 7, 1990, the twins have been widely covered in the media, and even had their own reality TV show on TLC in 2012. Today they are elementary school teachers.
The Hensel twins separated into two partial bodies after day 9 of development but before day 14. They are extremely rare, not only conjoined but also “incomplete” and “dicephalic” (two heads). Each twin has her own neck, head, heart, stomach, gallbladder, lung, and nervous system, and one leg and arm. They share a third arm that was removed, a large liver, a single bloodstream, three kidneys, a large ribcage and diaphragm muscle, and organs below the navel. Because at birth Abigail and Brittany were strong and healthy, doctors suggested surgery to separate them. But their parents, aware of other cases where only one child survived separation, declined surgery.
The Hensel family has provided a photo of the twins for the development chapter of my human genetics textbook for many editions. Each time, their mom reviews the context before granting approval. In their photo in the fourteenth edition, being published in September, Abigail and Brittany are in a beautiful apple orchard.
If conjoined twins are rare, incomplete twins rarer, then a fetus-in-fetu is rarer still, occurring in only one in half a million live births, with about 200 reported in the medical literature. An early case, in 1808, described a boy who had a fetal twin inside his abdomen. Another young boy had a partial twin in his scrotum.
The New Case
The one-year-old of the current case had a large head, her brain squished due to buildup of cerebrospinal fluid filling in one of the four ventricles. She also had motor delay. CT scans revealed the partial, malformed fetus. The twins had shared a single chorion but had individual amniotic sacs.
The twinning occurred at the blastocyst stage of the embryo, the researchers deduced from the structures present. That’s the hollow ball of cells from which the embryo emerges from a collection of cells on the inner face. After two such cell collections formed, one enveloped the other, with the anterior swelling that would become the head.
The fetus with arrested development had only a vertebral column, some limb bones, and buds where fingers would have developed. But that was distinctive and organized enough to indicate that it was in fact a partial fetus, and not the hodgepodge of fetal tissues called a teratoma. Plus, teratomas tend to be discovered in adults, not one-year-olds.
Comparing genomes supports the enveloped fetus hypothesis. The fetus and one-year-old have identical single nucleotide polymorphisms (SNPs, or single-DNA-base variants) across their genomes, indicating that they were identical. But beyond that, at the structural rather than the informational level, the genomes differ profoundly, with the fetus’s riddled with DNA repeats.
A striking illustration in the Neurology paper shows four circles that indicate DNA repeats in the genomes of the mother, father, one-year-old, and partial fetus. Red lines represent places in the genomes that harbor many short repeated DNA sequences. The genome maps of the parents and daughter have a few red lines, but that of the partial fetus has a vibrant red ring of many repeats.
Something obviously went haywire in the DNA replication process for the fetal twin, peeling off copies of the same sequences like a typo typo typo …
The Lexicon and Context of DNA Repeats
DNA repeats are quite interesting. They impart a different type of information than the DNA base triplets of a gene that encode an mRNA molecule that the cell translates into a specific protein. The protein-encoding part of a human genome, the exome, is actually only about 1.5% of the 2 billion or so DNA bases. Repeats take up a lot of the remainder.
Instead of encoding protein, repeated short DNA sequences provide a subtext, like a hidden theme in a work of fiction that lingers in the background of the main narrative.
Physically, DNA repeats block the transfer of genetic information. It’s all a matter of chemistry. The symmetry of short repeats bends the DNA double helix into shapes, such as hairpins, due to bonding within the strand. For example, consider a stretch of DNA bases: CGTAGCATATATATATGTACTT … . The AT repeats in the center could loop out, align so an A pairs with a T at several sites, and bend that section of the molecule into a hairpin loop.
The shapes that repeats dictate then interfere with DNA replication, and the expansion can grow as sections repeatedly misalign. Even if a DNA repeat is part of a protein-encoding gene, if it is transcribed into mRNA and translated into protein, the result is an extra-bulky protein. And repeats gum up the works in other ways. They disable the cellular garbage dumps (proteasomes) that dismantle debris and block expression of other genes that include similar repeat sequences. Or, short DNA repeats simply trigger cell death (apoptosis).
Where Have We Seen DNA Repeats Before?
DNA repeats entered the public mindset in the mid 1980s, when Sir Alec Jeffreys of Leicester University realized that this hidden form of genetic information could be used to distinguish individuals. He invented DNA fingerprinting, now called DNA profiling. I wrote the cover story in Discover magazine on the first criminal case in the US, “DNA Fingerprints: New Witness for the Prosecution.”
Two types of repeats have been used in forensics. VNTRs (variable number of tandem repeats) are 10-80 bases long, and were used at first. Then STRs (short tandem repeats) of 2 to 10 bases came into use. Their shorter length makes them better able to withstand harsh conditions, such as the aftermath of a plane crash or natural disaster.
DNA repeats run amok lie behind about two dozen diseases, many neurological. The first to be identified were myotonic dystrophy and Huntington’s disease. The repeats misalign and copy themselves, over and over, causing an “expanding repeat disease.” Juvenile Huntingtons Disease: the Cruel Mutation here at DNA Science tells the story of a child who had 99 triplet DNA repeats in the huntingtin gene, which usually has 26 or fewer repeats – double the length of the repeat she inherited from her father. Symptoms in the expanding repeat diseases are usually associated with more than 40 copies, typically of 3 or 4 bases.
The discovery of out-of-control DNA repeats in the fetus-in-fetu and the role of repeats in toddlers experiencing various delays and disabilities suggest their role in overseeing development. So might repeats also contribute to pregnancy losses? Perhaps this has flown under the radar because most expelled embryos and fetuses don’t have their DNA checked for repeats – just chromosome counts. Even testing for specific disease-causing genes would miss repeats.
Media coverage focused on the bizarre nature of the fetus-in-the-brain. But the findings may have repercussions on managing pregnancies, explaining some miscarriages and stillbirths, and understanding how some brain-related symptoms that arise in toddlerhood develop.
And I couldn’t help but wonder how US states that restrict abortion rights would have responded to the discovery of the fetus-in-fetu. Would the physician who removed the partial fetus and the one-year-old have been prosecuted?